prk7 ha s6k1 (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
prk7 ha s6k1
Prk7 Ha S6k1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 44 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prk7+ha+s6k1+wt/pRK7-HA-S6K1-WT+(Plasmid+%238984)/pm41802695-76-27-28
Average 93 stars, based on 44 article reviews
Prk7 Ha S6k1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 44 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prk7+ha+s6k1+wt/pRK7-HA-S6K1-WT+(Plasmid+%238984)/pm41802695-76-27-28
Average 93 stars, based on 44 article reviews
prk7 ha s6k1 - by Bioz Stars,
2026-10
93/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: HMGA2 and protein leucine methylation drive pancreatic cancer lineage plasticity Article Snippet: .. After annealing following standard protocols, hybridized oligos were digested with MluI and EcoRI and subcloned into pRetroHMGA2. Article Title: Ribosomal S6 kinase 1 regulates inflammaging via the senescence secretome. Article Snippet: EcoHelper (pCL-Eco, Addgene) was used for the retroviral infection of MEFs. .. For the S6K rescue experiments, HA-tagged coding sequences of either WT or K100R S6K1 rat cDNA were PCR amplified from either Article Title: Ribosomal S6 kinase 1 regulates inflammaging via the senescence secretome Article Snippet: EcoHelper (pCL-Eco, Addgene) was used for the retroviral infection of MEFs. .. For the S6K rescue experiments, HA-tagged coding sequences of either WT or K100R S6K1 rat cDNA were PCR amplified from either Polymerase Chain Reaction:Article Title: Ribosomal S6 kinase 1 regulates inflammaging via the senescence secretome. Article Snippet: EcoHelper (pCL-Eco, Addgene) was used for the retroviral infection of MEFs. .. For the S6K rescue experiments, HA-tagged coding sequences of either WT or K100R S6K1 rat cDNA were PCR amplified from either Article Title: Ribosomal S6 kinase 1 regulates inflammaging via the senescence secretome Article Snippet: EcoHelper (pCL-Eco, Addgene) was used for the retroviral infection of MEFs. .. For the S6K rescue experiments, HA-tagged coding sequences of either WT or K100R S6K1 rat cDNA were PCR amplified from either Amplification:Article Title: Ribosomal S6 kinase 1 regulates inflammaging via the senescence secretome. Article Snippet: EcoHelper (pCL-Eco, Addgene) was used for the retroviral infection of MEFs. .. For the S6K rescue experiments, HA-tagged coding sequences of either WT or K100R S6K1 rat cDNA were PCR amplified from either Article Title: Ribosomal S6 kinase 1 regulates inflammaging via the senescence secretome Article Snippet: EcoHelper (pCL-Eco, Addgene) was used for the retroviral infection of MEFs. .. For the S6K rescue experiments, HA-tagged coding sequences of either WT or K100R S6K1 rat cDNA were PCR amplified from either Clone Assay:Article Title: Ribosomal S6 kinase 1 regulates inflammaging via the senescence secretome. Article Snippet: EcoHelper (pCL-Eco, Addgene) was used for the retroviral infection of MEFs. .. For the S6K rescue experiments, HA-tagged coding sequences of either WT or K100R S6K1 rat cDNA were PCR amplified from either Article Title: Ribosomal S6 kinase 1 regulates inflammaging via the senescence secretome Article Snippet: EcoHelper (pCL-Eco, Addgene) was used for the retroviral infection of MEFs. .. For the S6K rescue experiments, HA-tagged coding sequences of either WT or K100R S6K1 rat cDNA were PCR amplified from either Retroviral:Article Title: Ribosomal S6 kinase 1 regulates inflammaging via the senescence secretome. Article Snippet: EcoHelper (pCL-Eco, Addgene) was used for the retroviral infection of MEFs. .. For the S6K rescue experiments, HA-tagged coding sequences of either WT or K100R S6K1 rat cDNA were PCR amplified from either Article Title: Ribosomal S6 kinase 1 regulates inflammaging via the senescence secretome Article Snippet: EcoHelper (pCL-Eco, Addgene) was used for the retroviral infection of MEFs. .. For the S6K rescue experiments, HA-tagged coding sequences of either WT or K100R S6K1 rat cDNA were PCR amplified from either Sequencing:Article Title: Ribosomal S6 kinase 1 regulates inflammaging via the senescence secretome. Article Snippet: EcoHelper (pCL-Eco, Addgene) was used for the retroviral infection of MEFs. .. For the S6K rescue experiments, HA-tagged coding sequences of either WT or K100R S6K1 rat cDNA were PCR amplified from either Article Title: Ribosomal S6 kinase 1 regulates inflammaging via the senescence secretome Article Snippet: EcoHelper (pCL-Eco, Addgene) was used for the retroviral infection of MEFs. .. For the S6K rescue experiments, HA-tagged coding sequences of either WT or K100R S6K1 rat cDNA were PCR amplified from either Generated:Article Title: SRC inhibition enables formation of a growth suppressive MAGI1-PP2A complex in isocitrate dehydrogenase-mutant cholangiocarcinoma Article Snippet: .. Human MAGI1c-Y373F–green fluorescent protein (GFP) mutants were generated from pCMV6-AC-GFP-MAGI1c WT (Origene, #RG212712) by site directed mutagenesis using the following primers: CATAGTAGATACCAAAGCAGGG TCTTCAATCTTTTCCCAAC and GTTGGGAAAAGATTGAA GACCCTGTCTTTGGTATCTACTATG. pCMV SRC WT and Mutagenesis:Article Title: SRC inhibition enables formation of a growth suppressive MAGI1-PP2A complex in isocitrate dehydrogenase-mutant cholangiocarcinoma Article Snippet: .. Human MAGI1c-Y373F–green fluorescent protein (GFP) mutants were generated from pCMV6-AC-GFP-MAGI1c WT (Origene, #RG212712) by site directed mutagenesis using the following primers: CATAGTAGATACCAAAGCAGGG TCTTCAATCTTTTCCCAAC and GTTGGGAAAAGATTGAA GACCCTGTCTTTGGTATCTACTATG. pCMV SRC WT and other:Article Title: Oxidative stress from DGAT1 oncoprotein inhibition in melanoma suppresses tumor growth when ROS defenses are also breached Article Snippet: |